THE INFORMATION BELOW WILL CHANGE THE WAY YOU THINK ABOUT THE GLOBAL MESS WE'RE IN TODAY CAUSED BY A SO-CALLED 'VIRUS.' WHAT YOU'LL FIND HERE WILL BLOW YOUR MIND. NOBODY TELLS IT AS IT IS. IT'S ALL, AS YOU'LL DISCOVER, ABOUT MONEY – AND LOTS OF IT FOR THOSE IN ON IT. BE PREPARED TO SEE THE WORLD IN NEW LIGHT...

The following is a transcript of a video published on the ‘Before It’s News’ website called “Proof Fauci and Pharma Running a RICO Criminal Conspiracy” by Reiner Fuellmich and Dr. David E. Martin. You can watch the two-hour long, but to-the-point interview here. However, as a good chunk of the video is in German, the transcript below will be great for those with short attention spans, little knowledge of biological science, or with not much time to spare. Don't worry about scientific terms you don't understand as they are explained nicely in the text.

We now have information that will NAIL the CRIMINALS against we the people for good, and end this Covid nightmare. Those scumbags are MAKING MONEY, and PILES of it on OUR BACKS.


Transcript

Patent applications are registered for all to see. That being so, they're a gold mine of EVIDENCE against patent filers that later on use those patents to COMMIT CRIMES. With patents, we can not only track what’s happening but who's involved in nefarious activities.

Let it be known that over 4,000 patents have been issued over the SARS Coronavirus. We have PROOF that the SARS COVID-2 virus is a subclade of the SARS beta Coronavirus family and that the entire Covid affair is for financial gain.

FYI:  Coronaviruses are a group of related viruses that look crowned. A virus is a microscopic agent that replicates only inside the living cells. So now you know. Here's a picture of a coronavirus:

SARS COVID 2
Red: spike proteins (S) Gray: lipid bilayer envelope Yellow: envelope proteins (E) Orange: membrane proteins (M)

FYI:  In genetics, a subclade is a subgroup of a haplogroup. A haplogroup is a combination of alleles at different chromosomal regions that are closely linked and that tend to be inherited together. An allele is one of two, or more, forms of a given gene variant. So now you know.

The 'reported' gene sequence of the virus was that of a 'new' or 'novel' Coronavirus. However, over 120 patented pieces of evidence suggest that the declaration of a 'novel' Coronavirus is actually an entire fallacy. There was NO 'novel' Coronavirus. Instead, there are numerous modifications of Coronavirus sequences that have been uploaded to computers, but there was NO single identified 'novel' Coronavirus at all. Furthermore, in the patent records, there are filings attributed to novelty in patents going right back to 1999. So, not only is the Covid-2 virus NOT a 'novel' anything, it’s NOT been novel for over two decades.

The filings of Coronavirus applications up until 1999 were solely for veterinary purposes. The first vaccine patented for Pfizer was specifically for the S spike protein

FYI:  Spike proteins (peplomers) are the knoblike structures (see the above picture) made of glycoproteins (proteins which contain oligosaccharide (sugar) chains (glycans) covalently attached to amino acid side-chains) projecting from the lipid bilayer of the surface of an enveloped virus. the S1 subunit contains a receptor-binding domain that engages with the host cell receptor angiotensin-converting enzyme 2 and the S2 subunit mediates fusion between the viral and host cell membranes. So now you know.

So, the exact same thing that has been rushed into invention was filed in January 2000, and the idea that scientists 'mysteriously' stumbled on the way to intervene with vaccines is not only ludicrous but incredulous. It's utter bullshit. Furthermore, that patent was for a vaccine for rabbits. That coronavirus is one of the multiple forms of the coronavirus. It was all about rabbits and the breeding of rabbits.

The big problem is that Anthony Fauci and the National Institute for Allergy and Infectious Diseases, the NIAID, found the malleability of the Coronavirus to be a potential candidate for the HIV vaccine. So, SARS is NOT a natural progression of a genetic modification, of a Coronavirus. In 1999, Fauci funded research at the University of North Carolina Chapel Hill specifically to create an infectious replication-defective Coronavirus. That patent was filed in April 2002. It was specifically targeted at human lung epithelial cells. In other words, HUMANS MADE SARS and patented it in 2002 before there was ever any alleged outbreak in Asia, which followed that by several months.

That patent, issued as US 7279327, clearly lays out the gene sequencing showing that we knew about the ACE receptor, the binding domain, and the S1 spike protein.

FYI:  ACE2 is a protein on the surface of many cell types. It's an enzyme that generates small proteins – by cutting up the larger protein angiotensinogen – that then go on to regulate functions in the cell. Using the spike-like protein on its surface, the SARS-CoV-2 virus binds to ACE2 – like a key being inserted into a lock – prior to entry and infection of cells. Hence, ACE2 acts as a cellular doorway – a receptor – for the virus that 'causes' so-called COVID-19. A receptor-binding domain (RBD) is a key part of a virus located on its 'spike' domain that allows it to dock to body receptors to gain entry into cells and lead to infection. So now you know.

These and other elements are now known as the scourge pathogen. Not only was it engineered, but it can be synthetically modified in the lab with nothing more than gene-sequencing technologies using computer code and turning it into the pathogen or an intermediate of the pathogen. The Coronavirus was considered to be a vector to distribute HIV vaccines.

Bill Gates, the computer geek, promotes vaccines, and must think that computing is a tool to create pathogens. He obviously thinks that computer viruses are the same a natural viruses. THEY'RE NOT, Mr. Gates. That's why YOUR vaccines KILL.

It gets worse. Patent offices were told to monitor chemical weapons and Treaty violations in early 2000. Recall the Anthrax scare events of 2001 following 9/11. Bayer had a drug that was a potential treatment for Anthrax poisoning. In the Fall of 2001, the patent offices witnessed a lot of activity to do with bacterial pathogens being patented through the NIH, the NIAID, the US armed services, and their international collaborators. The concern was that Coronavirus was seen as a potential manipulative agent for a vaccine vector and a biological weapon candidate. In other words, 20 years ago, the patent offices warned us of a problem looming on the horizon about Coronavirus being used as a bioweapon. Now we know.

The Coronavirus as a pathogen inside the Coronavirus model is NOT new, as it has been known for two decades. After the alleged 2002/3 outbreak of SARS in Asia, the US CDC (Centers for Disease Control) filed a patent for the entire gene sequence of the SARS Coronavirus, which is a violation of the US code stating that natural substances CANNOT be patented. That’s why Bill Gates couldn’t patent the lemon. The CDC filing has several derivative patents covering the gene sequence of the SARS Coronavirus and the means of detecting it using the PCR (Polymerase Chain Reaction) technique. That’s a big problem because if you own the patent for the gene itself AND own the patent on its detection, you can control 100% of the provenance of the virus itself and its detection, meaning you have the entire scientific and message control. This patent, sought by the CDC, was allegedly justified by public relations reasons so that anyone can research Coronavirus. The problem is that the statement is a LIE because the patent office rejected it twice as the gene sequence was already in the public domain.

In other words, before the CDC filed for a patent, the patent office found 99.99% of the identity with the already existing Coronavirus recorded in the public domain. However, In 2006/7, the CDC overrode the patent office by BRIBERY and got the patent for the SARS Coronavirus! WTF!

When the CDC claims that everything it does is in the public interest, it's a load of rubbish because it's falsifiable by their bribery to the patent office. To make matters worse, they paid an additional fee to make the patent PRIVATE. All this is in the public patent record.

Fact-checkers have repeatedly stated that the 'novel' Coronavirus known as SARS COV 2 is 'distinct' from the CDC patent. The trouble is that you CANNOT have a 'distinct' virus that’s ALSO a SARS. The fact-checkers haven’t a clue what they’re talking about. The CDC filings in 2003, 2005, and 2007 show high similarities to SARS. In other words, the so-called COVID-19 strain is none other than that of the CDC's. It’s NOT new.

Three days after the CDC filed the patent in 2003, the Maryland company Sequoia Pharmaceuticals filed a patent for antiviral treatment and control of infections by Coronavirus. The CDC made a filing for the pathogen, and three days later, the treatment was filed. Today, Sequoia Pharmaceuticals is part of Pfizer and tied to Johnson & Johnson. Something really stinks. This absorption of a corporation stinks to high heaven. We’re seeing a money-making scam evolving. How’s it possible to have a treatment for a thing that was invented three days earlier?

Patent #71151163 issued to Sequoia Pharmaceuticals was allotted and published BEFORE the CDC’s patent was allowed. That’s proof of INSIDER INFORMATION. It’s IMPOSSIBLE to patent a thing on something the CDC had paid to be kept secret!

The above is the definition of CRIMINAL CONSPIRACY, RACKETEERING, AND COLLUSION. You CANNOT have a treatment for a thing not known to exist. This whole thing will blow up into a RICO case; Racketeer Influenced and Corrupt Organizations Act (RICO) passed in 1970.

Moderna got the spike protein sequence by phone from the Vaccine Research Center at the NIAID prior to the definition of the 'novel' subclade. How do you treat a thing before you have the thing? You couldn’t make it up! We’re dealing with buffoons here. They must think we’re all dumshit. Admit it; the entire Covid crap is a racketeering exercise to line the pockets of all those involved in this scam.

You’ve got to look at who’s making money on everything to do with the Covid scam worldwide. Who’s selling the face masks? Who’s supplying the PCR test kits? Who’s making money on the jabs? Who’s supplying the body bags? Why are autopsies no longer done? Why are the vax manufacturers not liable for deaths and injuries caused by their jabs? Why are detention centers being built? Who’s paying for them? Why 2, 3, or 4 jabs? Why the fake Covid variants all of a sudden? Ask questions—QUESTION EVERYTHING. We know that Matt Hancock, the former UK Health Minister, has investments in a Porton Down pharmaceutical company. When you go down this rabbit hole, you’ll find a huge warren of corruption, lies, and deceit.

It’s the end of fiat money as the quantum financial banking system comes, meaning that corrupt central banks can no longer print money to line their pockets. Gold-backed currencies are all accounted for and can’t be just printed off. So, could it be that the Covid racket is the gangsters’ last chance to fill their pockets before the reset comes?

On 5 June 2008, DARPA (the US Defense Advanced Research Projects Agency) took an interest in Coronavirus as a bioweapon, and patents were filed for the unique feature of the SARS COV 2 virus. Specifically, they targeted the polybasic cleavage site, the spike protein, and the ACE receptor binding domain, which is allegedly 'novel' to SARS COV 2. Those patents were issued between 24 November 2015 (after the Gain of Function moratorium and after the MERS outbreak in the Middle East) and 2019. In 2016, 2017, and 2019, a series of patents covering not only the RNA strands (Ribonucleic acid) but also the sub-components of the gene strands were all issued to Sanofi and another concern. Countless other companies and institutes around the world and in the US have been identified in patent filings between 2008 and 2017, and every attribute that was allegedly uniquely published by VEE single reference publication, the novel bat Coronavirus, revealing the natural insertions of the S1 and S2 2-cleavage site for the spike protein and possible recombinant origin of the SARS COV 2 virus.

There's a paper that’s been routinely used to identify the ‘novel’ virus. Unfortunately, if you take what they report to be 'novel,' you find that 73 patents were issued between 2008 and 2019 which have the elements that are allegedly novel in the SARS COV 2 virus! Specifically as it relates to the cleavage sites, the binding domain, and the spike protein. So, the statement that there are clinically 'novel' components of the clinically unique, clinically contagious virus is total BULLSHIT. There was NO outbreak of SARS because all of the elements were ENGINEERED.

In 2016, the paper that was funded by the Gain of Function moratorium that stated that the SARS COVID 2 virus was poised for human emergence, written by Ralph S. Baric, Ph.D., Chapel Hill, NC, was also poised for human exploitation 73 times. Ralph told an audience in a speech that you can make a lot of money with this. You certainly can, and he has made a lot of money doing this.

Somebody knew something in 2015/16. It was made clear of the need for the public to understand the need for medical countermeasures for such a thing as a pan coronavirus vaccine. A KEY driver for this is the scamming MAINSTREAM MEDIA, and the economics that follow the HYPE. That hype would be used to the racketeers’ advantage to get to the real issues. Investors will respond if they see PROFIT at the end of the process.

There wasn’t a lab leak. This was an intentional bio weaponization of spike proteins to inject into people to get them ADDICTED to a pan coronavirus vaccine. This has nothing to do with a released pathogen. Every study that has ever been launched to try to verify a lab leak is a red herring.

There’s NOTHING 'new' about the SARS COV 2 virus. 73 patents on everything clinically novel. 73 patents, all issued BEFORE 2019. YOUR GOVERNMENT HAS BEEN LYING TO YOU. There's no NEW virus out there. There was NO release of ANYTHING because patent #7279327 about the recombinant nature of the lung-targeting coronavirus was mysteriously transferred from the University of North Carolina, Chapel Hill, (UoC CH) to the NIH (National Institutes of Health) in 2018. Under the Bayh–Dole Act or Patent and Trademark Law Amendments Act (1980), United States legislation dealing with inventions arising from federal government-funded research means that the US government already has a marching right provision. In other words, since the US gov has paid for the research, it’s entitled to profit from it. So why in 2017 did the NIH have to take ownership of a patent they already had the rights to, held by the University of Carolina? Every typographical error in the patent was corrected. On the single patent required to develop the Vaccine Research Institute’s mandate, which was shared by the UoC CH, in November 2019 the University, Moderna, and the NIH began sequencing a spike protein vaccine – a month BEFORE the first Covid-19 outbreak.

IT’S ALL ABOUT MONEY – WE HAVE ALL THE EVIDENCE

The script for the plandemic was written first on 6 January 2004. That was the year when Dominion voting machines came on the scene, but that might be just a coincidence. The script was written by Merck at a conference called SARS and Bioterrorism. The script is titled Bioterrorism and Emerging Infectious Diseases, Antimicrobials, Therapeutics, and Immune Modulators.

Merck introduced the idea of The New Normal, which is the language that became the branded campaign that the WHO adopted, the Global Preparedness Monitoring Board, which was the board upon which the Chinese director of the CDC – Bill Gate’s Dr. Alias of the Gate’s Foundation – and Anthony Fauci sat together. The New Normal was about getting people to accept a coronavirus vaccine, which was adopted on 6 January 2004.

Moderna knew it would be placed in front of the line with respect to the development of a vaccine in March 2019. During that month, Moderna suddenly amended four rejected patent filings to specifically reference an intentional or deliberate release of coronavirus to begin the process of a coronavirus vaccine development. They began with a significant problem they had, which was that they relied on technology they didn’t own.

Two Canadian companies, one of which owns the patent on the lipid envelope required to deliver the injection of the mRNA fragment, became involved. Those patents are available worldwide. Moderna negotiated with Arbutus and Acuitas, the two Canadian outfits, to get the resolution of the lipid nanoparticle patented technology available to be put into a vaccine. In November, they went into research with UoC CH to get the spike protein to go inside the lipid nanoparticle. That meant they had a candidate vaccine BEFORE the pathogen was allegedly said to be running around. It reeks of corruption.

FYI:  messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of synthesizing a protein. So now you know.

NOTHING IS RUNNING AROUND

We know that from 2016 to 2019, at every one of the NIAID advisory council board meetings, that Fauci lamented the fact that he couldn’t get enough people to accept the universal flu vaccine, which was his pet target. FOLLOW THE MONEY.

In the amended Moderna patent filings of 2019, there was that epiphany of “what if there’s a deliberate release of a respiratory pathogen?” That question is recited in the book 'A World at Risk,' the same scenario put together by the WHO in 2019, months before there was an alleged pathogen. It said that we need to have a collective global experience of a respiratory pathogen release, which by September 2020 must put in place a universal capacity for public relations management, crowd control, and the acceptance of a universal vaccine mandate. The bastards!

The patent records prove that there’s NO novel coronavirus out there. It’s all HYPE to get the ignorant public to accept a jab or two, or three or even more, depending on how many fake strains are invented and blurted out by the likes of fake president Biden and leader of the UK’s Rump Parliament, Johnson. Notice that the plandemic ONLY became prominent shortly after Brexit on 1 January 2020. The rest of the so-called leaders worldwide in Western countries are ALL IN ON THIS racketeering exercise for the money, an easy way to bring in communism through the back door, and population control

A MASSIVE CRIME AGAINST HUMANITY HAS OCCURRED BY BIG PHARMA AND HEADS OF STATE. THE LAMESTREAM MEDIA IS GUILTY AS HELL FOR NOT REPORTING THE TRUTH – IT’S TIME TO STRIKE BACK

The WHO declared in 2007/8 that the world had eradicated the coronavirus, so why were billions spent on a vaccine? It falls into the zone of incredulity.

The bastards behind all this see the coronavirus as a highly malleable bioweapon. By 2005 it was unquestionably a weapon of choice against we the people. Unfortunately, many well-meaning people have fallen victim to this scam. We’re NOT having a vaccine for a fake virus. We’re receiving an mRNA spike protein sequence by injection, which is a computer-simulated sequence and NOT derived from nature. The ludicrous statement that the jabs are prophylactic or preventative flies in the face of 100% of the evidence because the evidence makes it abundantly clear that there has been NO effort by any pharmaceutical company to combat the so-called virus. Notice that big pharma went after cheap antivirals like hydroxychloroquine, HCQ. They couldn’t have that in the way of their racketeering, could they? The bastards.

It’s about getting people jabbed with the known to be harmful S1 spike protein. The cover story is that if you get an expression of a spike protein, you’re going to get some general symptomatic relief. BULLSHIT. The fact of the matter is that there has NEVER been an attempt to vaccinate a population as defined by the vaccination universe. Here’s what the patent office told Fauci WHY his attempt to get his synthetic RNA anti-HIV vaccine patented as a vaccine was rejected:

“These arguments are persuasive to the extent that an antigenic peptide stimulates an immune response that may produce antibodies that bind to a specific peptide or protein, but it is NOT persuasive with regards to a vaccine. The Immune response produced by a vaccine must be more than a response – it must also be PROTECTIVE. A vaccine is a compound that PREVENTS infection. The applicant has NOT demonstrated that his vaccine meets even the lower standard put forth in the specification, let alone meeting the standard for being operative.”

Fauci’s vaccine failed to meet the patentable standard, the legal standard, or the clinical standard. In other words, Fauci is incompetent. He hasn’t a clue what he’s doing, yet stupid politicians, the NIAID, and so-called philanthropists think he’s the bee’s knees and knows best. HE’S A FRAUDSTER and GANGSTER out to fleece innocent and gullible plebeians. With him are the lamestream media parasites and world leaders who haven’t a brain between them. 

HOW MUCH LONGER ARE WE GOING TO ALLOW THESE FAKERS TO SMASH ECONOMIES AND MURDER PEOPLE?

The Fauci dossier is ready, and all the necessary documentation is at hand when the PROOF is be needed at tribunals. So-called conspiracy theorists (a derogative term dug up by the criminals in the CIA for those who discover or get too close to the truth) can no longer be denounced. The difference between a conspiracy theory and the TRUTH is 6 to 12 months, BTW.
Politicians like Boris Johnson say that the Delta variant is more contagious than anything else, yet it’s all MEDIA HYPE!

There’s NO SUCH THING AS AN ALPHA, BETA, GAMMA, DELTA, EPSILON, ZETA. ETA, THETA, IOTA, KAPPA, LAMBDA, MU, NU, OMICRON, PI … da, da, da, coronavirus variant.

Covid variants are a cheating means by which what is desperately sought is a degree to which individuals can be coerced into accepting something they would otherwise not accept

No published studies on the fake Delta variant have shown calculated populations of the replication rate. Only computer simulations have been estimated. BTW, math and computer simulations are NOT science. In the case of the Covid-19 virus, not a single sample has ever been isolated because it DOESN’T exist. Without an isolated sample, it’s IMPOSSIBLE to manufacture a preventative vaccine.

WE’VE ALL BEEN TOLD EFFING LIES

No one has clinically identified any altered gene sequence. YOUR POLITICIANS AND LAMESTREAM MEDIA ARE LYING TO YOU!

To ask silly questions like “Why do people show responses to certain infections said to be caused by the Delta strain?” is them simply responding to media HYPE. The fact that silly, brainwashed clinicians are looking for the variant DOESN’T mean the variant exists. They can find a gene fragment – AAAATTCCTACGAAAGGCCTAGCA – or whatever and call it after any letter of the Greek alphabet to hoodwink the ignorant. These dumshit researchers are simply copy-and-paste machines following the narrative unthinkingly. They’re NOT scientists; they’re jobsworth technicians, and they know that. Anyone with half a brain can see right through this scam. 

FOLLOW THE MONEY – FOLLOW THE POLITICAL PLOT TO FORCE UPON US TOTALITARIANISM

Genomes are sequenced by a compositing process (the combination of visual elements from separate sources into single images, often to create the illusion that all those elements are parts of the same scene). Technicians simply use a ‘reading frame’ to see which purines (Adenine and Guanine, A and G) and pyrimidines (Cytosine and Thymine, C and T) are paired in a sequence. They can start and end anywhere, clip the strand here or there, and call that clipped artificial sequence ANYTHING they want in order to put fear in the gullible, who will then want to take the next booster vax. The Dusseldorf variant, the Paris variant, the ‘caused by the football match variant,’ the FOLLOW THE MONEY variant.

ALL THIS WAS KNOWN 20 YEARS AGO

In order to make a protective non-toxic vaccine, a precise natural DNA or RNA sequence is needed. Not similar to, but the EXACT sequence. The exact sequence that’s gone into the vaccines seems to be elusive. It can’t be stated with 100% certainty what the sequence is. Fragments are identified without specificity. We don’t have terminal ends of the fragments, just what’s seen in the reading frames. There are hypothecated gaps into which anything can be placed. So, the fact-checkers are CLUELESS.

FACT-CHECK THE FACT-CHECK CHECKERS

Follow the money, and the lies will be exposed. The novelty of the new virus strains has NEVER been addressed; therefore, it’s a manufactured ILLUSION creating an illusion of demand.

IGNORE THE LAMESTREAM MEDIA HYPE

Want to know what we’re dealing with here? The common flu hyped up as something DANGEROUS and DEADLY.

KEEP AN EYE ON THE AUDIT AND WHAT’S GOING ON IN THE BANKS

If what we’re looking for is something we’ve decided we’ve decided is worth looking for, we’ll find it.

We’ll find it in a bunch of places. If we decide we’re no longer looking for something, then we won’t find it. We see this crap in astroscience when fictitious dark matter or dark energy is looked for. No one’s found these yet, but no doubt someone will – but it’ll be bloody hard to prove that something that doesn’t exist actually exists. A paradigm change is needed in astroscience to get away from the nonsense—the same with the biological sciences, which are being taken advantage of for financial gain.

The influenza virus, from which NOBODY died last year – all deaths were attributed to Covidhasn’t vanished. It’s what’s been causing respiratory illness over the last winter as usual. That hospitals were NOT full but much quieter than normal, says it all. Some were empty. Just wait until the whistleblowers come forward when the Covid fraud is exposed for all to see soon. Then heads will roll.

The Nuremberg Trials must reopen.

Now find out which industry is behind this scam. GET READY FOR A SURPRISE...